To investigate transport function of sialic acid transporter (sialin), we employed baculovirus overexpression system with Bac to Bac system (Invitrogen/Life Technologies, Carlsbad, CA). The advantage of this system is availability of a large quantity of functional eukaryotic transporter. Here we show the method “cloning and transfection of sialic acid transporter”. |
Category | Nucleotide sugar transporters |
Protocol Name | Cloning and transfection of lysosome sialic acid transporter gene |
Authors
|
Miyaji, Takaaki
Department of Genomics and Proteomics, Advanced Science Research Center, Okayama University
Omote, Hiroshi
*
Department of Membrane Biochemistry, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama University
Moriyama, Yoshinori
Department of Membrane Biochemistry, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama University
*To whom correspondence should be addressed.
|
KeyWords |
|
Reagents
|
● |
pENTR/D-TOPO cloning kit (Invitrogen/Life Technologies, Cat No. K2400) |
● |
LR Clonase Enzyme Mix (Invitrogen/Life Technologies, Cat No. 11791) |
● |
Bac to Bac Baculovirus Expression System (Invitrogen/Life Technologies, Cat No. 10359-016) |
|
Instruments
|
|
Methods |
1. |
Cloning and transfection of lysosome sialic acid transporter gene
|
1) |
PCR amplification of mouse Sialin cDNA (Accession No. NM172773) using specific primers 5’- CACCATGAGGCCCCTGCTTCGGGGTC -3’ and 5’- TCAGTTTCTGTGTCCGTGGTGGTCAC -3’. Note CACC sequence should be attached to 5' end of initial ATG. |
Comment 0
|
|
2) |
Ligation into a pENTR/D-TOPO vector. |
Comment 0
|
|
3) |
Generate pDEST10-sialin (destination vector designed for baculovirus system) by LR recombination. As a result of recombination, a sequence encoding N-terminal 6xHis tag is added to the 5' end of sialin cDNA. |
Comment 0
|
|
4) |
Transform DH10Bac cells carrying bacmid DNA by pDEST10-sialin to generate recombinant bacmid in vivo. |
Comment 0
|
|
5) |
Isolation of recombinant bacmid from DH10Bac cells by mini prep. |
Comment 0
|
|
6) |
Transfection of Sf9 cells (insect cell) by isolated recombinant bacmid using cellfectin. |
Comment 0
|
|
7) |
Incubation at 3–5 days at 27°C.
TNM-FH medium (Gibco/Life Technologies) supplemented with 10% fetal bovine serum, 0.25 μg/mL fungizone and 100 μg/mL penicillin-streptomycin is used for sf9 cell culture. |
Comment 0
|
|
8) |
Isolate medium containing baculoviruses and removal of sf9 cells by centrifugation (700 × g, 5 min). |
Comment 0
|
|
9) |
Carry out plaque assay for determination of viral titer. |
Comment 0
|
|
10) |
Infect Sf9 cells by recombinant baculoviruses at a multiplicity of infection of one and culture further 72 h. |
Comment 0
|
|
|
Notes | Recombinant baculoviruses containing sialin cDNA were constructed using the Bac-to-Bac Baculovirus Expression System according to the manufacturer’s protocol. |
Copyrights |
Attribution-Non-Commercial Share Alike
This work is released underCreative Commons licenses
|
Date of registration:2015-12-17 11:17:54 |
- Miyaji, T., Echigo, N., Hiasa, M., Senoh, S., Omote, H., and Moriyama Y. (2008) Identification of a vesicular aspartate transporter. Proc. Natl. Acad. Sci. USA. 105, 11720–11724 [PMID : 18695252]
|
This work is licensed under Creative Commons Attribution-Non-Commercial Share Alike. Please include the following citation
How to Cite this Work in an article:
Miyaji, Takaaki,
Omote, Hiroshi,
Moriyama, Yoshinori,
(2015). GlycoPOD https://jcggdb.jp/GlycoPOD.
Web.27,4,2024 .
How to Cite this Work in Website:
Miyaji, Takaaki,
Omote, Hiroshi,
Moriyama, Yoshinori,
(2015).
Cloning and transfection of lysosome sialic acid transporter gene.
Retrieved 27,4,2024 ,
from https://jcggdb.jp/GlycoPOD/protocolShow.action?nodeId=t95.
html source
Miyaji, Takaaki,
Omote, Hiroshi,
Moriyama, Yoshinori,
(2015).
<b>Cloning and transfection of lysosome sialic acid transporter gene</b>.
Retrieved 4 27,2024 ,
from <a href="https://jcggdb.jp/GlycoPOD/protocolShow.action?nodeId=t95" target="_blank">https://jcggdb.jp/GlycoPOD/protocolShow.action?nodeId=t95</a>.
Including references that appeared in the References tab in your work is
much appreciated.
For those who wish to reuse the figures/tables, please contact JCGGDB
management office (jcggdb-ml@aist.go.jp).
|
|