Cloning and transfection of lysosome sialic acid transporter gene

Authors：

Category

Nucleotide sugar transporters

Protocol Name

Authors

Miyaji, Takaaki
Department of Genomics and Proteomics, Advanced Science Research Center, Okayama University

Omote, Hiroshi *
Department of Membrane Biochemistry, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama University

Moriyama, Yoshinori
Department of Membrane Biochemistry, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama University

*To whom correspondence should be addressed.

KeyWords

Sialin Baculoviruses Overexpression system Insect cells

Reagents

●	pENTR/D-TOPO cloning kit (Invitrogen/Life Technologies, Cat No. K2400)
●	LR Clonase Enzyme Mix (Invitrogen/Life Technologies, Cat No. 11791)
●	Bac to Bac Baculovirus Expression System (Invitrogen/Life Technologies, Cat No. 10359-016)

Instruments

●	Clean bench

Methods

Cloning and transfection of lysosome sialic acid transporter gene

1)	PCR amplification of mouse Sialin cDNA (Accession No. NM172773) using specific primers 5’- CACCATGAGGCCCCTGCTTCGGGGTC -3’ and 5’- TCAGTTTCTGTGTCCGTGGTGGTCAC -3’. Note CACC sequence should be attached to 5' end of initial ATG.	Comment 0

2)	Ligation into a pENTR/D-TOPO vector.	Comment 0

3)	Generate pDEST10-sialin (destination vector designed for baculovirus system) by LR recombination. As a result of recombination, a sequence encoding N-terminal 6xHis tag is added to the 5' end of sialin cDNA.	Comment 0

4)	Transform DH10Bac cells carrying bacmid DNA by pDEST10-sialin to generate recombinant bacmid in vivo.	Comment 0

5)	Isolation of recombinant bacmid from DH10Bac cells by mini prep.	Comment 0

6)	Transfection of Sf9 cells (insect cell) by isolated recombinant bacmid using cellfectin.	Comment 0

7)	Incubation at 3–5 days at 27°C. TNM-FH medium (Gibco/Life Technologies) supplemented with 10% fetal bovine serum, 0.25 μg/mL fungizone and 100 μg/mL penicillin-streptomycin is used for sf9 cell culture.	Comment 0

8)	Isolate medium containing baculoviruses and removal of sf9 cells by centrifugation (700 × g, 5 min).	Comment 0

9)	Carry out plaque assay for determination of viral titer.	Comment 0

10)

Infect Sf9 cells by recombinant baculoviruses at a multiplicity of infection of one and culture further 72 h.

Comment 0

Notes

Recombinant baculoviruses containing sialin cDNA were constructed using the Bac-to-Bac Baculovirus Expression System according to the manufacturer’s protocol.

Copyrights

Attribution-Non-Commercial Share Alike
This work is released underCreative Commons licenses

Date of registration：2015-12-17 11:17:54